DNA 101

I want to try to blog here once a week – which will probably mean the weekends. All week, I was thinking about what I would write about, and I was all set to explain genetically engineered food products and how, while they certainly need to be regulated and created safely, they aren’t the death threat some critics make them out to be.

In doing a little research for this topic, I came across the 2005 Eurobarometer – a report describing the public opinion of various technologies (including genetic engineering). One survey given was to gauge general ‘textbook’ knowledge about genetics and science. The results from three questions shocked me and gave me a new inspiration for this post. But before we get to that, here are the three questions-in-question:

     1.  True or false: By eating a genetically modified fruit, a person’s genes could also become modified.

     2. True or false: Ordinary tomatoes do not contain genes, while genetically modified tomatoes do.

     3. True or false: Human cells and genes function differently from those in animals and plants.

If you answered false to these questions, you are right! If you didn't, sadly, you are in good company: only 54%, 41%, and 34% of respondents correctly answered each question, respectively.

I did not take this picture.

Well, it is clear that a tutorial is in order before the intricacies of genetic engineering can be discussed. So, I present to you: DNA 101.

DNA = your genes.

DNA is actually an acronym for the technical chemical structure (deoxyribonucleic acid) of all your genetic material. This molecule resides inside the nucleus of every single one of your cells. Not just your cells, but the cells of every single living thing. That means humans and bacteria; plants and animals.

DNA is the chemical that is able to store all your genes in one place, so that it can be replicated (like when a cell divides) and passed on (to your kids through your eggs or sperm) without mistakes and at the proper time. Think of it as the library for the blueprint of your genes: a safe place to store all that genetic information until you need it. Again, this is not something special to humans: everything alive has the same chemical – DNA – for coding their genes!

What do genes look like? On paper, they look like a bunch of letters – As, Ts, Cs and Gs – all in a row. These letters also stand for the chemical names (adenosine, tyrosine, cytosine, and guanidine) of the bits that are connected together to make one long strand of DNA. Just as an example, here is the sequence of the gene that codes for insulin in human beings:

agccctccaggacaggctgcatcagaagaggccatcaagcagatcactgtccttctgccatggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactagacgcagcccgcaggcagccccacacccgccgcctcctgcaccgagagagatggaataaagcccttgaaccagcaaaa

[NCBI Reference Sequence: NM_000207.2]

From DNA to a protein

OK, so how does that DNA sequence get from a jumble of letters to insulin?

First, when you (or any living thing) wants a gene to be “on,” it has to take it from its storage state (DNA) to its more active state (RNA, another acronym for ribonucleic acid).

Why this middle-man, RNA? Well, DNA doesn’t stop at the end of one gene. That insulin sequence above is connected to many other genes all on a single chromosome (the packing unit of DNA). But you don’t necessarily want alllll those genes “on” at one time. So, you only make RNA from the parts you want. It’s like making a photocopy of a single chapter from a book in the library; or looking at the details of a single room on a blueprint.

RNA looks a lot like DNA – only instead of the letter T, you have the letter U – just a slightly different chemical, and unless you’re trying to make a gene, it’s not so important.

But it’s still a jumble of letters that looks nothing like insulin.

Insulin is a protein. DNA and RNA are not. How do you make a protein from something that is not a protein? Well, the reason DNA is called the genetic code is because it is just that: it is a code for making protein. If you start at the beginning of a gene, every 3 letters codes for one letter of a protein.

Huh?

Well, just as DNA and RNA can be written on paper as a string of letters, so can proteins. Instead of using just 4 letters, proteins are made up of 20! That is, there are 20 different molecules that can be strung together in different combinations to make every protein in your body – or every protein in a bacteria.

That insulin DNA sequence above gets made into the following protein:

MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN

[NCBI Reference Sequence: NP_000198.1]

Yes, I know what you’re thinking. It’s still a string of letters. But this is a different string of letters! THIS string of letters is made of different molecules, that have different shapes, sizes, and electric charges – all properties that allow this string of letters to fold and look and behave like – insulin!

This structure was solved by researchers in Denmark in 1997.

 And because I know you’re dying to know: this is what it looks like! All those nice spiral ribbons are the backbone – the general arrangement of all those letters in space. The black and gray circles are parts of the molecules that stick out from the backbone and give different chemical properties to the protein. Didn’t know you could do THAT with a bunch of letters, did you?

So, just think about it: every single protein in your body – and in every living thing – starts out as DNA! And every time your body needs a certain protein, it can go to the DNA, copy the gene it needs into RNA, and then decode the RNA to make protein. Pretty amazing, huh?

Obviously, there are some differences in the DNA between you and bacteria, otherwise we’d be bacteria. But it’s really not a huge difference – the basics are the same: bacteria and you both have DNA made up of A, T, C, G; this DNA gets copied to RNA; this RNA gets decoded into the same 20 letters of proteins. Some of these sequences have been changed over evolution. And we obviously don’t need the same genes for say, photosynthesis, that plants do.

Related to the above survey, your genes are strictly regulated – incredibly so. They don’t have minds of their own, and they’re not just moving about, jumping from place to place. (Disclaimer: there are examples of genes moving from one organism to another, but it happens over evolution and very rarely. Nothing for you to worry about). Think of all the bacteria you have living in your gut right at this very instant: their DNA stays with them and your DNA stays with you. When you eat a tomato – even the ordinary ones – the DNA from the tomato doesn’t jump into your cells and turn your skin red.  

So, that’s the basic story of how your genes make YOU. And how bacteria genes make bacteria, tomato genes make tomatoes, etc. I find it remarkable how all these complex organisms can be so diverse and even function at all, from the same four letter code of DNA. Simple is usually best!

I hope you can now pass the survey questions with flying colors.

Nor this one.

While it was a bit depressing to be inspired to write this tutorial, it was kind of fun! I think I’ll be on the lookout for other topics in the future!

Miracle Drug (?)

The popular media has been all a flurry about the recent AIDS drug trial: in a study involving 889 South African women, a microbicide vaginal gel was found to reduce HIV infection by 39%. This data was first reported at the International AIDS Conference in Vienna, with a concurrent publication in the journal Science. The World Health Organization (WHO) and the United Nations publicly praised the study as a “landmark proof of concept study,” one that will “open new possibilities for HIV prevention.”

Of course, as is wont to happen when the popular media reports on a scientific discovery, the press releases have gotten exaggerated in order to make the story more sexy. Of course, more people will read a story entitled “Groundbreaking' gel halves HIV infection rates” than one called “AIDS gel study is an important proof-of-concept.” So, one story is read by the masses, and one read by scientists, and this dichotomy should not exist.

So, what’s the real deal? I was not at the AIDS conference but I can access the Science publication to summarize: the AIDS gel study is an important proof-of-concept. It is also an important teaching tool for the how the media doesn’t always translate scientific findings very well, and how statistics are used in reporting scientific data.

First, the basics of the study: it was a double-blind randomized trial of 889 South African women between the ages of 18 – 40. What does this mean? Double-blind means neither the women nor the doctors giving them treatment knew if the gel they were using was a placebo (that is, did not contain the microbicide drug tenofovir) or not. Randomized means the women volunteers were randomly assigned to the placebo or tenofovir gel group so that there would be no bias based on age, residence, number of sex acts, etc. The women reported their sex acts, condom usage, and returned used applicators, so the researchers could calculate adherence to the instructions. Women were tested for HIV infection and pregnancy (since the safety of the gel was not known for pregnant women) every 30 days over the course of the 30-month study. If a woman was found to be HIV-positive, she was removed from the study and referred to an AIDS treatment clinic immediately. Basically, this all means that the only variable in the study was the presence of the drug in the gel; as the researchers put it: “[The] protective effect is evident irrespective of sexual behavior, condom use, herpes simplex type 2 virus infection, or urban/rural differences.” Overall, the researchers report an overall reduction in infection of 39%, and up to 54% in the women who adhered most stringently to the instructions of the drug regimen.

These are the conclusions trumpeted by the media. Responsible scientific journalists would also inform the public that at no point do the researchers claim this is a cure for AIDS or will be available tomorrow or will solve all the world’s problems with just two applications a day. On the contrary, the researchers as well as the experts at the WHO and UN caution that this is a small trial, one that needs to be repeated, and that many questions are still unanswered – something, thankfully, that the NY Times did report.

And what about the statistics I mentioned before? Well, let’s take a look at where that 39% value comes from: the infection rate was 5.6 in the drug group compared to 9.1 in the placebo group. 5.6 is 39% lower than 9.1. But that’s not a lot of women, is it? However, by considering the probability for error based on the sample size, the statistics show that the probability that the differences between the two groups (placebo and drug) are due to chance and not to the drug is very low. This means that even though the absolute numbers do not look so different, they are “statistically significant.”

Some people scoff at this phrase. And while it’s true that statistics can be used or ignored to make data seem more impressive, the statistics can’t change the data. It’s important to know the limitations of statistics and to relate them to the risks involved. For example, you all are inundated with poll numbers before elections: so-and-so is leading the polls 52% to 48%. Warning! This number is an average, which means there is a range, which means there is a source of error. If this error is only 3 percentage points, this difference means absolutely nothing. However, a reporter isn’t going to make the news for saying the “poll is not statistically meaningful.” This highlights the catch-22 of scientific reporting: statistics can make significance out of very small differences, and make very large differences seem meaningless.

So, what’s the take-home here?

Don’t believe the numbers the media tells you from scientific articles – remember in the end they are trying to sell you something: in this case, a cure for AIDS. If they’re not giving you the full picture, complete with statistics, a red flag should go up.

Statistics are powerful but know their limitations: 39%, while significant, is not a cure for AIDS. On the flip side, just because the raw numbers aren’t impressive doesn’t mean they are meaningless.

Go to the source: the researchers clearly outline the limitations of their study, as do the UN and WHO. Read between the lines of the media press releases – obviously they will be filled with words like “groundbreaking” and “monumental,” but the words “potential” and “promise” usually signal that this isn’t the end of the end of the research.

And, always remember that science is never conducted in a bubble. The implications of this, and any, clinical trial reach far beyond the difference between placebo and drug. In this case, the most significant impact may be the power of preventative treatment controlled completely by women. In a country where approximately 3.2 million women are currently living with HIV (2007 estimate), 39% prevention is a pretty good place to be starting.

Programming Note

My latest real-life research has led me to the conclusion that finding the time to start a new research-intensive blog is not possible when also working on getting two manuscripts out.

That said, I've been compiling a list of things I want to write about. Looking at that list every day reminds me that I actually DO have things to say, and finding the time to compose something should be easier in the near future as the manuscripts are thisclose to being sent to journals.

Oo-ooh, that smell.

Growing up in a region of the States where mosquitoes grew to monstrous proportions, forcing us to sweat around the campfire in skin-encasing pants and long-sleeved shirts, worrying if we’d all spontaneously combust due to the cloud of DEET forming a force-field around us, I think I’ve heard all derivations of methods to keep mosquitoes away and why they’re attracted to people – some more than others. For me and for most of us living in industrialized countries, finding ways to repel mosquitoes is mostly just about nuisance. We want to avoid those irritating itchy bumps and sleepless nights from that one damn mosquito that got trapped in the bedroom with us. However, for hundreds of millions of people living in sub-Saharan Africa, South America, and Southeast Asia, repelling mosquitoes is really a life-or-death battle.

The reason we in the States and other industrialized nations don’t have to worry about anything more than a mosquito bite (and the occasional West Nile virus scare) is because the mosquito species (Anopheles gambiae, for the Latin-proficient) that transmits the most fatal malaria parasite (another tongue-twister: Plasmodium falciparum) was successfully eradicated from these regions. In third-world countries, the mosquitoes still wreak havoc on the population. Of course, the hot and humid climate is perfect for these little pests. But the problem is much bigger: these are poor, undeveloped nations without the infrastructure or financial resources to implement large-scale eradication procedures. There have been great successes with insecticide-treated bed nets, but obviously a lot more work needs to be done, since 1-3 million people still die from malaria every year, making it one of the top three infectious disease killers (the other two being HIV-AIDS and tuberculosis).

Fortunately, scientists are on the case to figure out what attracts mosquitoes to humans. Even better, they know something more than what we grew up hearing: “you’re just not sweet enough,” or “just stop breathing and they won’t bother you.” Actually, mosquitoes have special odorant receptors in their neurons that let them “smell” different chemicals. That’s right, even though mosquitoes don’t have noses, they can smell! There are many different types of these odorant receptors that allow the mosquitoes to detect different chemicals – very similar to how humans can detect different odors (Su C et al. Cell 2009;139(1):45-59). A fascinating article was just published in the journal Nature, in which the authors wanted to know exactly which receptors were responsible for detecting human odors – no, not the odors you and I can detect on a crowded subway, but the chemicals we emit just by being human (Carey AF, et al. Nature 2010;464:66-71). The researchers did something really tricky: they knew the gene for each individual receptor. They also had mutant fruit flies that were missing their odorant receptors. The scientists could insert the mosquito receptor into a fruit fly neuron! Why is this so cool, other than just the simple fact that they could technically do this? Because they could put one receptor into one neuron, without all the other receptors around, and they could tell exactly what each receptor could respond to. In other words, they have a neuron with receptor A, and another with receptor B. They expose these neurons to different chemicals, some of which are found in human odors. If neuron A responds to a chemical, but not neuron B, the scientists would know that receptor A allows the mosquito to recognize this chemical. Some chemicals activated just one receptor, while some chemicals activated several; some receptors were activated by a small range of chemicals, while others by a large range (the researchers called this “tuning”).

These findings are really important to finding new ways to eradicate mosquitoes. If researchers can find receptors that let mosquitoes recognize humans, they can start researching how to block this response. If the mosquito can’t find her next meal, the consequences are pretty obvious. Or, if researchers can figure out the main chemicals being recognized by the mosquitoes, they can design traps to lure the mosquitoes away from human populations. Importantly, these techniques wouldn’t involve giving medicine or treatments to people or interfering with their daily lives.

What's this all about?

02.26.12: Addendum

The below was true at its time and still is, mostly. The blog suffered as I wrote papers and moved from abroad back to the States at the end of my postdoc. I am now out of academia and fully immersed in making the transition from lab rat to writer. So far, this has meant some freelance and contract work. The blog is being dusted off to build my online presence, to practice writing, and to have a format in which I can have the freedom to discover what niche I want to put myself in. 

Happy reading.

emb


Greetings from jaded-postdoc-writer-wannabe-land.

Somewhere in my march from undergrad biochemistry degree, subsequent PhD in pharmacology, and current postdoctoral fellowship, I have realized that as much as I love science, I don't want to be doing it anymore. It has nothing to do with my scientific career thus far - on the contrary, I've been blessed with fascinating research projects and supportive advisers and colleagues along the way. I just don't want to have my own lab in an academic setting.

This brings me to my present quandary: how to acquire skills and experience that don't involve a lab bench and a microscope, while not abandoning my postdoc, which gives me both security that I don't "have" to find a job right now and will soon increase the number of publications on my CV, which never hurt anyone.

My current state of soul-searching in this matter (which, thankfully, has moved past the "just quit and jump into the world of freelancing without any formal experience! Who needs a paycheck?!" state) is to find time to do what I want to be doing, even on a small scale.

That brings me to the next problem: what is it that I want to be doing? I love science: I love talking about it, learning about it, analyzing it. I also love to write. Seems like a no-brainer: science writing. But in what medium? In what style? I haven't developed myself as a writer. I have zero formal writing experience. I can write lab reports, grants, and research articles like a champ, but if that's what I wanted to do for the rest of my life, I'd be an academic researcher.

The other morning, I was spending hours I will never get back deteriorating my eyesight and my posture at the microscope doing some really mindless trained-monkey stuff (for the sake of posterity, you will get no details as to my current position). I had this sort of out-of-body epiphany, which caused me at once to realize the tragedy and comedy of the situation. What was I doing?? In that moment of clarity and depression, I had a clear idea of the kind of science writer I wanted to be. My favorite scientific conversations are with non-scientists. I get the most thought-provoking and challenging questions and viewpoints when I'm trying to explain what I do to my non-scientist friends and family. Unlike many of my colleagues, I LIKE explaining what I do to my mother. I want to write for all the non-scientist mothers out there. I want to translate the scientific jargon and boil it down to what really matters, what's really important, and the ways of interpreting it. I think scientists, in general, do a fantastically horrible job of stepping off their "these are the facts so you should believe them" pedestal to take the time to explain the basics, explain the evidence, explain the counter-evidence, so that everyone - mothers, politicians, policy-makers, media - can interpret what the science is saying.

So that brings me here. To begin my quest to bridge the communication gap between scientists and their mothers.

Why a blog? It avoids any conflict-of-interest with my current position. I can do it on my own time, with my own word-count and weekly production limits. Even if no one reads this, it's a challenge to myself to keep up with the literature outside of my field and present it here. At the very least, I'll be acquiring "writing samples" for any future job inquiries. I'm sure the format will change and evolve - I hope so! Right now, I see this blog as being a combination of commenting on popular science in the media, presenting current research articles I think are cool, and discussing conversations and interactions I have with scientists and non-scientists alike over a scientific topic. I want to avoid being too political - with the disclaimer that this is really really hard for me to do, especially around certain subjects. I want my role to be translator, because there are enough scientists out there ready to put the interpretation into your lap without explaining the data behind the interpretation.