Lean, green protein-making machines

When researchers become enamored of a particular protein and want to study it, one of the first things they do is figure out how to get their hands on a LOT of it. That way, they can put it in test tubes, add and subtract different chemicals and alter the conditions and environment (temperature, pH, etc.) to figure out what really makes the protein act the way it does.

It may seem reasonable to suggest that these researchers just go collect the protein from its natural source. After all, the organism that produces the protein must be pretty good at it, right?

Ok, so if a researcher is studying a human protein, they can come after you with a needle for regular plasma draws or have you pee in a cup and filter out the protein from your fluids… but what happens if they are studying a protein that you pretty much suck at making, that is made in a few different varieties depending on whether or not you’re healthy or sick, that isn’t found in your blood or urine? Would you want researchers to come after you to extract, for instance, GREB1, which is found in prostatic tissue and prostate cancer? Probably not…

guyism.com

But there is good news for you and your prostate: scientists have been making proteins in the lab for a long time! (Time out: if you need a little DNA/protein tutorial, go on back to my DNA 101 post). So what is the recipe for a protein?

1.     Take the DNA sequence that codes your protein and put it into an organism that won’t care if you’re all up in its prostrate

2.     Turn that organism into a protein factory, letting it churn out millions of copies of your protein

3.     Isolate—filter—your protein out of all the other gunk

4.     Viola! You now have gobs of your favorite protein to use to your heart’s content

Ok, so of course some of these steps are a little more complicated than just waving a magic science wand. In fact, I hear a stampede of grad students (my younger self included) at my door, ready to skewer me for compacting years of blood, sweat, and tears into a few flippant bullet points. 

talkandroid.com

 But the important technological advance here is to hijack a biological system in order to do your heavy lifting.

What are the types of critters scientists use as their workhorses? Usually bacteria and yeast; sometimes insect, plant, or mammalian cells that can live in culture. The key property is that these cells grow quickly and robustly and merrily make protein, even protein that it wouldn’t normally make from the extra gene that you put into it.

And that, my dears, is how you make perfect protein every time! (how do you type a Julia Child voice?) apronstrings.com

So, if this technology has been around for a long time and is the part of the Materials and Methods section in a scientific paper that gets glossed over (unless you’re one of those grad students trying to do the same thing), why am I going on and on about it?

Because a research group out of the University of California, San Diego, has figured out how to use algae—that green gunk that covers ponds and lakes and smells funny—to make a malaria protein.

Honestly, this in and of itself isn’t something I’d normally find inspiration in to write about, other than the fact that I love keeping up on malaria research.

The reason I found this study so interesting is the fact that in all my various E-mail subscriptions and Twitter feeds and Facebook updates, I kept reading about it! Sure, the fact that they used algae is kind of cool, but scientists are always trying to find the best organism to use to get the most protein they can. So why was it everywhere?

Marketing! That’s how! This study is a perfect case study of knowing how to make your story sexy. I don’t know if these researchers have a publicist or what, but seriously, it’s brilliant: use the algae to produce a protein that could potentially be a MALARIA VACCINE TARGET, and suddenly you’ve got an angle. Now, instead of a headline (that would never be written because it’s boring) reading “Researchers Add Another Organism to a Long List of Things That Can Make Protein in the Lab,” they get ones like “Biologists Produce Potential Malarial Vaccine from Algae." Much better.

I don’t want to trivialize the importance of this study, nor do I want to make it sound like they’re undeserving of the press. I personally think this is really freaking cool, based on the fact that I did my thesis project on malaria and on the fact that it’s a prime example of how scientists can make their work accessible to the general public. They do not say they have cured the disease or found a vaccine; instead, they have given their finding potential context and a reason for people to care.

And giving people a reason to care and instilling in them passion is, in my opinion, where science communication often falls flat.

So, kudos to Stephan Mayfield and his team for their success and for being an example of how you can do good science, do science well, and write about both for your fellow scientists and for the general public.

I can haz medicines?

The concept of personalized medicine seems to be trending as one of the “next big things” when it comes to advances in medical treatment. The principle is simple: each individual has a different genetic background, so everyone will have a slightly different susceptibility to different diseases or different responses to different treatments. Basically, the same reasons that make me a 5’4” white female with athletic build and brown eyes (call me!) and you something else – our genes – are the same reasons that we may each develop a different kind of cancer, need different doses of pain medication (or alcohol) to take care of a headache, or have different symptoms when exposed to the same allergen or flu virus. (Yes, there are environmental factors involved. But I would argue that even those, eventually, come back to the genes – the way the body responds is all about the genes).

There are tests currently available that can identify specific genetic markers (for example, the so-called “breast cancer gene,” BRCA) that are used by physicians to advise treatment or preventative courses of action. In fact, testing kits can be mailed to any curious individual – simply swab your cheek, send your spit to a testing company, and you will be provided with your very own genome sequence! Of course, what you do with that information is slightly unclear (and controversial), so it seems more prudent to get your doctor somehow involved in things that involve, you know, your health.

A recent push for developing relatively fast and cheap methods to sequence genes has led to a huge increase in technology to make whole-genome sequencing technically possible for laboratories. That said, the day of submitting a blood sample to your doctor to be run through a machine and immediately spitting out your own personal profile is far away. Which is probably a good thing; I’m not sure health insurance as we know it would be able to handle it (as opposed to the stellar job it does now).

Another wrinkle in the whole personalized medicine concept is the fact that it’s not just a patient’s genes that are important. Your genes make all the bits and pieces of your cells that make up you – and it’s not uncommon for, say, a protein to be affected without there being a difference in the gene that makes that protein. So, tests wouldn’t just need to decipher your genetic makeup, but also the make up of all those “bits and pieces.” This is where the field of “omics” comes in.

“Omics” has turned into a catch-all suffix that basically means “all the things" and, when applied rigorously, how all these things interact. Genomics = all the genes and how they interact with each other. Proteomics = all the proteins and how they interact with each other. Proctrastanomics = all the stuff you were supposed to be doing while you played Words with Friends and how that interacts with the likelihood of you being productive. Like any meme that infiltrates the internet – cat videos, “Shit so-and-so says,” and Tebow-ing spoofs – the “omics” suffix causes varying degrees of reactions, from the exuberant “OMG that's so awesome, ROTFL!” to the more subdued “LOL” to the outright annoyed “WTF I’m blocking your posts.” Count me in the camp that thinks that “omics” tends to be overused and misused as a buzzword. I mean, “Pharmacomicrobiomics investigates the effect of variations within the human microbiome on drugs.” Seriously?

However, when used correctly, the concept can be powerful, as it was in the recent Cell publication by Rui Chen and colleagues. This study analyzed various “omics” of one individual over 14 months to see how all those bits and pieces changed over time. (I say individual and not patient because the subject was healthy and not hospitalized.) The scientists tested the individual’s blood for what genes were turned on and off, what proteins were being made, what antibodies were being produced, and what metabolic processes were occurring. During the course of the study, the individual had a couple of infections and developed signs being at risk for Type 2 diabetes.

(Parenthetically, after the study was published, the subject revealed himself to be the lead investigator of the report, Dr. Michael Snyder of Stanford. He now joins the ranks of such self-experimentalists as Jonas Salk, who gave himself the polio vaccine, Albert Hoffmann, who synthesized and then took LSD, and Dr. Jekyll, who transformed himself into Mr. Hyde.)

Throughout it all, a picture of the subject’s “omic” profile was painted (referred to as iPOP – talk about a meme), revealing the potential strength this kind of analysis would have in personalized medicine. The fact that the subject began the study healthy was also of interest: not only should patients be analyzed after becoming sick, but the normal workings of a person’s “omics” should also be monitored – the onset of diabetes in the experimental subject may not have been observed if not for this study. The analysis also showed what happened to the “omic” profile over the course of an infection and treatment regimens, which also provides information as to how the infections progress and how they can be treated most effectively.

Now, we can’t all have a group of dedicated scientists analyzing our blood for all these bits and pieces every day. Even though the costs of doing such analyses are decreasing, spending a few thousand dollars every time one of the tests is run is still not exactly chump change. That, and it’s not like you can just call up these guys and have them repeat all of this on your blood. They probably have other things to do. But, this study is a fantastic proof-of-principle of the potential value of acquiring this amount of data from individuals.   

 

The Devil May Care

February Journal Club

I’m guessing that when most people think of the Tasmanian Devil, they think of this guy: 

That loveable, cuddly (ok, maybe not so much) character from the Warner Bros. Looney Tunes cartoons.

The cartoon “Taz” had quite the appetite and left a path of destruction in his wake. His real-life cousins, the species Sarcophilus harrisii, are not so destructive or slobbery – and their particular taste for rabbits may not be clear – but they are carnivorous, speedy, and just about as cute.

http://upload.wikimedia.org/wikipedia/commons/4/43/Sarcophilus_harrisii_taranna.jpg

And, unlike the Taz this will be forever immortalized in cartoon form, the real-life Tasmanian devils are doomed: Taz’s cousins are becoming extinct because of cancer.

More ferocious than the devil itself is Tasmanian devil facial tumor disease (DFTD). This cancer causes disfiguring tumors on the faces of Tasmanian devils and interferes with their ability to eat, so infected devils actually die of starvation and not from the cancer directly. 

http://upload.wikimedia.org/wikipedia/commons/9/99/Tasmanian_Devil_Facial_Tumour_Disease.png

This cancer was first observed in 1996 and has quickly spread throughout the population of devils on the island of Tasmania, which is part of Australia. In 2006, a very important observation revealed the most unique characteristic of DFTD tumors: the tumor cells did not come from host animal.

Why is this so revealing? In most cancer types, tumors form because cells of the host somehow go awry. Even if something from the outside world causes the cancer (UV rays, smoking, human papillomavirus), the original source of the tumor is from the host, meaning that the DNA content of the tumor is the same as that of the host. Not exactly the same – there has to be at least one mutated gene otherwise it would be a normal cell and not a tumor cell – but close enough that if the DNA sequences of the host and tumor were compared, it would be clear that the tumor came from the host.

DFTD is different. In 2006, scientists found evidence that the DNA sequence from a tumor did NOT match that of its host, meaning the tumor cells had to come from elsewhere: another animal. And sure enough, the animals were giving each other cancer through the normal biting that occurs during mating and feeding. These tumor cells would essentially graft (stick) themselves onto the face of the victim of the bite and multiply there. The relative ease with which this occurs explains the rapid spread of DFTD throughout the Tasmanian devil population.

So, basically, DFTD is the vampire of the cancer world: it is immortal. Other cancers usually die with their host. Not DFTD: it lives on in the newly infected animals. Even though the first devil with the first case of DFTD has long since died (devils only live 5-6 years), that first tumor has essentially been cloned and started over with each new infection. As happens over time (think evolution), each clone may be slightly different than other clones due to random mutations, but all are variants of the same original tumor. To draw a comparison: when a human cancer metastasizes, or moves, it stays within the original host and moves from, for example, the breast to the lymph nodes. DFTD, though, metastasizes from one animal into another.

This property of being transmitted from animal to animal has wreaked havoc on the devil population but can also be used by researchers to study DFTD in the hopes of combating it. Instead of having to study this tumor in the lab, the devil population acts as a natural incubator, keeping the tumor cells alive indefinitely. By comparing the DNA sequences of normal devils to the sequences of present-day DFTD tumors, the following key questions can be studied:

1.     What makes the tumor cells different than normal devil cells and how is it able to cause disease?

2.     How has the cancer changed over time from the initial founder to the different lineages now found in nature?

3.     How did the cancer spread from one devil to the entire devil population?

These are precisely the questions raised by a group of researchers when they set out to sequence the genome of the Tasmanian devil and different DFTD tumors (Murchison EP, et al. (2012). Genome Sequencing and Analysis of the Tasmanian Devil and Its Transmissible Cancer. Cell 148(4): 780-791).

How can sequencing the genome of an animal and its cancer cells reveal so much about the history of the disease and how it works? It all has to do with comparing different sequences and analyzing what must have happened over the course of time to cause these changes.

Three genomes were sequenced: a normal, adult female devil and two tumors from different parts of Tanzania (in the paper, these are called the titillating names of 87T and 53T). The two tumors have undergone random mutations since they diverged from the original DFTD tumor. By comparing these mutations to each other, researchers can estimate what changes occurred after the tumors left the original host. If both 87T and 53T have the same mutation in gene X, this mutation probably was in the original tumor because it is not statistically likely that both tumors would separately have the exact same mutation in the exact same place. (Consider these odds: if the tumor DNA genome is about 3 billion units in size, then the chance of an identical mutation in 2 different genomes is a 1/3,000,000,000 x 1/3,000,000,000 = 1 in 9,000,000,000,000,000,000 chance. Take those odds to Vegas!)

By identifying the mutations present in the tumors and not in the normal devil genome, the original tumor DNA sequence could be deduced. Then, by comparing the tumor genome to the normal devil genome, the differences that make the normal cells “normal” and the tumor cells “tumorigenic” were revealed. For example, mutations were found in genes that are related to cancer in humans. Also, mutations were found in genes that would allow the tumor to “hide” from the host immune system, a property it has to have to be able to survive on the face of a devil.

Once the researchers identified where the differences were in the sequences of the two tumor genomes, these “hotspots” could be identified in hundreds of tumors throughout Tanzania. A sort of family tree was constructed to trace the spread of DFTD from the original devil to its present widespread distribution – a history of the disease.

Understanding the past development of DFTD is academically interesting, as is knowing what the original tumor “looked” like, but there are further implications beyond just basic curiosity. By knowing how DFTD evolved in the past, scientists can predict how it may change in the future and act to target these changes to prevent or stop the disease. Furthermore, there are still ways in which the data from this study can be analyzed. For instance, even though mutations were found in certain genes, the “how” question has not been answered: how these mutations cause DFTD. So far, only genes that are known to play a role in human cancers have been probed for the presence of mutations, but others could possibly be involved.

DFTD is well on its way to causing the extinction of an entire species. Understanding how the tumor cells are different than normal cells is key for developing therapy to cure or prevent DFTD. One other cancer is caused in the same way as DFTD (that is, is immortally transmitted through bites): a cancer of dogs, called canine transmissible venereal tumor (CTVT). The lessons learned from DFTD may be relevant to CTVT. So, if the soft spot in your heart for Taz isn’t big enough, think of Fido.

DNA 101

I want to try to blog here once a week – which will probably mean the weekends. All week, I was thinking about what I would write about, and I was all set to explain genetically engineered food products and how, while they certainly need to be regulated and created safely, they aren’t the death threat some critics make them out to be.

In doing a little research for this topic, I came across the 2005 Eurobarometer – a report describing the public opinion of various technologies (including genetic engineering). One survey given was to gauge general ‘textbook’ knowledge about genetics and science. The results from three questions shocked me and gave me a new inspiration for this post. But before we get to that, here are the three questions-in-question:

     1.  True or false: By eating a genetically modified fruit, a person’s genes could also become modified.

     2. True or false: Ordinary tomatoes do not contain genes, while genetically modified tomatoes do.

     3. True or false: Human cells and genes function differently from those in animals and plants.

If you answered false to these questions, you are right! If you didn't, sadly, you are in good company: only 54%, 41%, and 34% of respondents correctly answered each question, respectively.

I did not take this picture.

Well, it is clear that a tutorial is in order before the intricacies of genetic engineering can be discussed. So, I present to you: DNA 101.

DNA = your genes.

DNA is actually an acronym for the technical chemical structure (deoxyribonucleic acid) of all your genetic material. This molecule resides inside the nucleus of every single one of your cells. Not just your cells, but the cells of every single living thing. That means humans and bacteria; plants and animals.

DNA is the chemical that is able to store all your genes in one place, so that it can be replicated (like when a cell divides) and passed on (to your kids through your eggs or sperm) without mistakes and at the proper time. Think of it as the library for the blueprint of your genes: a safe place to store all that genetic information until you need it. Again, this is not something special to humans: everything alive has the same chemical – DNA – for coding their genes!

What do genes look like? On paper, they look like a bunch of letters – As, Ts, Cs and Gs – all in a row. These letters also stand for the chemical names (adenosine, tyrosine, cytosine, and guanidine) of the bits that are connected together to make one long strand of DNA. Just as an example, here is the sequence of the gene that codes for insulin in human beings:

agccctccaggacaggctgcatcagaagaggccatcaagcagatcactgtccttctgccatggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactagacgcagcccgcaggcagccccacacccgccgcctcctgcaccgagagagatggaataaagcccttgaaccagcaaaa

[NCBI Reference Sequence: NM_000207.2]

From DNA to a protein

OK, so how does that DNA sequence get from a jumble of letters to insulin?

First, when you (or any living thing) wants a gene to be “on,” it has to take it from its storage state (DNA) to its more active state (RNA, another acronym for ribonucleic acid).

Why this middle-man, RNA? Well, DNA doesn’t stop at the end of one gene. That insulin sequence above is connected to many other genes all on a single chromosome (the packing unit of DNA). But you don’t necessarily want alllll those genes “on” at one time. So, you only make RNA from the parts you want. It’s like making a photocopy of a single chapter from a book in the library; or looking at the details of a single room on a blueprint.

RNA looks a lot like DNA – only instead of the letter T, you have the letter U – just a slightly different chemical, and unless you’re trying to make a gene, it’s not so important.

But it’s still a jumble of letters that looks nothing like insulin.

Insulin is a protein. DNA and RNA are not. How do you make a protein from something that is not a protein? Well, the reason DNA is called the genetic code is because it is just that: it is a code for making protein. If you start at the beginning of a gene, every 3 letters codes for one letter of a protein.

Huh?

Well, just as DNA and RNA can be written on paper as a string of letters, so can proteins. Instead of using just 4 letters, proteins are made up of 20! That is, there are 20 different molecules that can be strung together in different combinations to make every protein in your body – or every protein in a bacteria.

That insulin DNA sequence above gets made into the following protein:

MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN

[NCBI Reference Sequence: NP_000198.1]

Yes, I know what you’re thinking. It’s still a string of letters. But this is a different string of letters! THIS string of letters is made of different molecules, that have different shapes, sizes, and electric charges – all properties that allow this string of letters to fold and look and behave like – insulin!

This structure was solved by researchers in Denmark in 1997.

 And because I know you’re dying to know: this is what it looks like! All those nice spiral ribbons are the backbone – the general arrangement of all those letters in space. The black and gray circles are parts of the molecules that stick out from the backbone and give different chemical properties to the protein. Didn’t know you could do THAT with a bunch of letters, did you?

So, just think about it: every single protein in your body – and in every living thing – starts out as DNA! And every time your body needs a certain protein, it can go to the DNA, copy the gene it needs into RNA, and then decode the RNA to make protein. Pretty amazing, huh?

Obviously, there are some differences in the DNA between you and bacteria, otherwise we’d be bacteria. But it’s really not a huge difference – the basics are the same: bacteria and you both have DNA made up of A, T, C, G; this DNA gets copied to RNA; this RNA gets decoded into the same 20 letters of proteins. Some of these sequences have been changed over evolution. And we obviously don’t need the same genes for say, photosynthesis, that plants do.

Related to the above survey, your genes are strictly regulated – incredibly so. They don’t have minds of their own, and they’re not just moving about, jumping from place to place. (Disclaimer: there are examples of genes moving from one organism to another, but it happens over evolution and very rarely. Nothing for you to worry about). Think of all the bacteria you have living in your gut right at this very instant: their DNA stays with them and your DNA stays with you. When you eat a tomato – even the ordinary ones – the DNA from the tomato doesn’t jump into your cells and turn your skin red.  

So, that’s the basic story of how your genes make YOU. And how bacteria genes make bacteria, tomato genes make tomatoes, etc. I find it remarkable how all these complex organisms can be so diverse and even function at all, from the same four letter code of DNA. Simple is usually best!

I hope you can now pass the survey questions with flying colors.

Nor this one.

While it was a bit depressing to be inspired to write this tutorial, it was kind of fun! I think I’ll be on the lookout for other topics in the future!

Miracle Drug (?)

The popular media has been all a flurry about the recent AIDS drug trial: in a study involving 889 South African women, a microbicide vaginal gel was found to reduce HIV infection by 39%. This data was first reported at the International AIDS Conference in Vienna, with a concurrent publication in the journal Science. The World Health Organization (WHO) and the United Nations publicly praised the study as a “landmark proof of concept study,” one that will “open new possibilities for HIV prevention.”

Of course, as is wont to happen when the popular media reports on a scientific discovery, the press releases have gotten exaggerated in order to make the story more sexy. Of course, more people will read a story entitled “Groundbreaking' gel halves HIV infection rates” than one called “AIDS gel study is an important proof-of-concept.” So, one story is read by the masses, and one read by scientists, and this dichotomy should not exist.

So, what’s the real deal? I was not at the AIDS conference but I can access the Science publication to summarize: the AIDS gel study is an important proof-of-concept. It is also an important teaching tool for the how the media doesn’t always translate scientific findings very well, and how statistics are used in reporting scientific data.

First, the basics of the study: it was a double-blind randomized trial of 889 South African women between the ages of 18 – 40. What does this mean? Double-blind means neither the women nor the doctors giving them treatment knew if the gel they were using was a placebo (that is, did not contain the microbicide drug tenofovir) or not. Randomized means the women volunteers were randomly assigned to the placebo or tenofovir gel group so that there would be no bias based on age, residence, number of sex acts, etc. The women reported their sex acts, condom usage, and returned used applicators, so the researchers could calculate adherence to the instructions. Women were tested for HIV infection and pregnancy (since the safety of the gel was not known for pregnant women) every 30 days over the course of the 30-month study. If a woman was found to be HIV-positive, she was removed from the study and referred to an AIDS treatment clinic immediately. Basically, this all means that the only variable in the study was the presence of the drug in the gel; as the researchers put it: “[The] protective effect is evident irrespective of sexual behavior, condom use, herpes simplex type 2 virus infection, or urban/rural differences.” Overall, the researchers report an overall reduction in infection of 39%, and up to 54% in the women who adhered most stringently to the instructions of the drug regimen.

These are the conclusions trumpeted by the media. Responsible scientific journalists would also inform the public that at no point do the researchers claim this is a cure for AIDS or will be available tomorrow or will solve all the world’s problems with just two applications a day. On the contrary, the researchers as well as the experts at the WHO and UN caution that this is a small trial, one that needs to be repeated, and that many questions are still unanswered – something, thankfully, that the NY Times did report.

And what about the statistics I mentioned before? Well, let’s take a look at where that 39% value comes from: the infection rate was 5.6 in the drug group compared to 9.1 in the placebo group. 5.6 is 39% lower than 9.1. But that’s not a lot of women, is it? However, by considering the probability for error based on the sample size, the statistics show that the probability that the differences between the two groups (placebo and drug) are due to chance and not to the drug is very low. This means that even though the absolute numbers do not look so different, they are “statistically significant.”

Some people scoff at this phrase. And while it’s true that statistics can be used or ignored to make data seem more impressive, the statistics can’t change the data. It’s important to know the limitations of statistics and to relate them to the risks involved. For example, you all are inundated with poll numbers before elections: so-and-so is leading the polls 52% to 48%. Warning! This number is an average, which means there is a range, which means there is a source of error. If this error is only 3 percentage points, this difference means absolutely nothing. However, a reporter isn’t going to make the news for saying the “poll is not statistically meaningful.” This highlights the catch-22 of scientific reporting: statistics can make significance out of very small differences, and make very large differences seem meaningless.

So, what’s the take-home here?

Don’t believe the numbers the media tells you from scientific articles – remember in the end they are trying to sell you something: in this case, a cure for AIDS. If they’re not giving you the full picture, complete with statistics, a red flag should go up.

Statistics are powerful but know their limitations: 39%, while significant, is not a cure for AIDS. On the flip side, just because the raw numbers aren’t impressive doesn’t mean they are meaningless.

Go to the source: the researchers clearly outline the limitations of their study, as do the UN and WHO. Read between the lines of the media press releases – obviously they will be filled with words like “groundbreaking” and “monumental,” but the words “potential” and “promise” usually signal that this isn’t the end of the end of the research.

And, always remember that science is never conducted in a bubble. The implications of this, and any, clinical trial reach far beyond the difference between placebo and drug. In this case, the most significant impact may be the power of preventative treatment controlled completely by women. In a country where approximately 3.2 million women are currently living with HIV (2007 estimate), 39% prevention is a pretty good place to be starting.

Programming Note

My latest real-life research has led me to the conclusion that finding the time to start a new research-intensive blog is not possible when also working on getting two manuscripts out.

That said, I've been compiling a list of things I want to write about. Looking at that list every day reminds me that I actually DO have things to say, and finding the time to compose something should be easier in the near future as the manuscripts are thisclose to being sent to journals.

Oo-ooh, that smell.

Growing up in a region of the States where mosquitoes grew to monstrous proportions, forcing us to sweat around the campfire in skin-encasing pants and long-sleeved shirts, worrying if we’d all spontaneously combust due to the cloud of DEET forming a force-field around us, I think I’ve heard all derivations of methods to keep mosquitoes away and why they’re attracted to people – some more than others. For me and for most of us living in industrialized countries, finding ways to repel mosquitoes is mostly just about nuisance. We want to avoid those irritating itchy bumps and sleepless nights from that one damn mosquito that got trapped in the bedroom with us. However, for hundreds of millions of people living in sub-Saharan Africa, South America, and Southeast Asia, repelling mosquitoes is really a life-or-death battle.

The reason we in the States and other industrialized nations don’t have to worry about anything more than a mosquito bite (and the occasional West Nile virus scare) is because the mosquito species (Anopheles gambiae, for the Latin-proficient) that transmits the most fatal malaria parasite (another tongue-twister: Plasmodium falciparum) was successfully eradicated from these regions. In third-world countries, the mosquitoes still wreak havoc on the population. Of course, the hot and humid climate is perfect for these little pests. But the problem is much bigger: these are poor, undeveloped nations without the infrastructure or financial resources to implement large-scale eradication procedures. There have been great successes with insecticide-treated bed nets, but obviously a lot more work needs to be done, since 1-3 million people still die from malaria every year, making it one of the top three infectious disease killers (the other two being HIV-AIDS and tuberculosis).

Fortunately, scientists are on the case to figure out what attracts mosquitoes to humans. Even better, they know something more than what we grew up hearing: “you’re just not sweet enough,” or “just stop breathing and they won’t bother you.” Actually, mosquitoes have special odorant receptors in their neurons that let them “smell” different chemicals. That’s right, even though mosquitoes don’t have noses, they can smell! There are many different types of these odorant receptors that allow the mosquitoes to detect different chemicals – very similar to how humans can detect different odors (Su C et al. Cell 2009;139(1):45-59). A fascinating article was just published in the journal Nature, in which the authors wanted to know exactly which receptors were responsible for detecting human odors – no, not the odors you and I can detect on a crowded subway, but the chemicals we emit just by being human (Carey AF, et al. Nature 2010;464:66-71). The researchers did something really tricky: they knew the gene for each individual receptor. They also had mutant fruit flies that were missing their odorant receptors. The scientists could insert the mosquito receptor into a fruit fly neuron! Why is this so cool, other than just the simple fact that they could technically do this? Because they could put one receptor into one neuron, without all the other receptors around, and they could tell exactly what each receptor could respond to. In other words, they have a neuron with receptor A, and another with receptor B. They expose these neurons to different chemicals, some of which are found in human odors. If neuron A responds to a chemical, but not neuron B, the scientists would know that receptor A allows the mosquito to recognize this chemical. Some chemicals activated just one receptor, while some chemicals activated several; some receptors were activated by a small range of chemicals, while others by a large range (the researchers called this “tuning”).

These findings are really important to finding new ways to eradicate mosquitoes. If researchers can find receptors that let mosquitoes recognize humans, they can start researching how to block this response. If the mosquito can’t find her next meal, the consequences are pretty obvious. Or, if researchers can figure out the main chemicals being recognized by the mosquitoes, they can design traps to lure the mosquitoes away from human populations. Importantly, these techniques wouldn’t involve giving medicine or treatments to people or interfering with their daily lives.